DNA & mRNA DESIGN STUDIO

Design DNA and mRNA
on your own machine.

Nucleora turns reference genomes into an interactive workbench: search a real antigen, codon-optimize it for the animal you're targeting, assemble a complete mRNA construct, fold the RNA, simulate the manufacturing run, and price out the order — all in one local-first window, with 530+ tools underneath when you need them.

Free while in development · macOS & Windows · your sequences stay on your computer

5′-ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTAC…-3′
Nucleora home dashboard — the guided three-step vaccine design workflow
530+
tools across the workbench
100%
local — nothing uploaded to fetch data
3 steps
antigen → mRNA → export
A–D
graded manufacturability report
WHAT IT DOES

The whole workflow, one window

No stitching together five web tools and a spreadsheet. Nucleora keeps the design, the analysis, and the numbers in the same place — real BioPython, real ViennaRNA folding, real codon-usage tables, computed on your machine.

🧬

Codon optimization

Re-code a protein for any host — including elephants, okapi, and other conservation species with real or clade-proxy codon tables — with a live before/after readout.

⚛️

mRNA construct design

Assemble T7 promoter, 5′UTR, Kozak, signal peptide, antigen ORF, 3′UTR and poly(A) into a therapeutic-style mRNA, with every part's provenance cited.

🌊

RNA folding

Fold with the ViennaRNA engine to see secondary structure, minimum free energy, and dsRNA/hairpin immunogenicity risk — computed locally.

🏭

IVT simulation & manufacture

Walk the construct through an in-vitro-transcription run, get a graded manufacturability report, then estimate yield, kinetics, and an itemized order form.

✂️

Cloning & primers

Restriction mapping, Gibson and Golden Gate assembly, and primer design via primer3 — with a built-in fallback where primer3 has no prebuilt wheel.

🔬

Lab bench, in silico

Virtual agarose gels, in-silico PCR, peptide property calculators, and pairwise/multiple alignment — the everyday bench assays, simulated.

CONSERVATION FOCUS

Built for the animals that don't have a codon table yet

Codon choice has to match the animal being dosed. Nucleora ships real codon tables built from NCBI RefSeq coding sequences for African elephant, Asian elephant, and cattle — and where a species like okapi or bongo has almost no sequenced genes, it optimizes using a documented, clade-anchored proxy instead of pretending the data exists.

real dataAfrican & Asian elephant, cattle, primates, big cats and more
proxyokapi, bongo — clade-anchored to a documented relative, never silent
Target-species picker showing real vs proxy codon data for conservation species
WHY NUCLEORA

Local-first, and honest about it

What Nucleora is

  • A design workbench for DNA and mRNA built on public reference genomes.
  • Local-first — your sequences are processed on your machine, not uploaded to a server.
  • Method-transparent — every number traces to a named, published algorithm.
  • Cross-platform — the same app on macOS and Windows.

What it isn't

  • Not a medical device and not a source of clinical or diagnostic advice.
  • Not a wet-lab substitute — designs still need real validation at the bench.
  • Not a data-harvesting cloud — nothing leaves your computer unless you fetch a public record.
  • Not locked-in — export standard sequence and GenBank/GFF3 formats any time.

See it run on real data

A real walkthrough of the Nucleora interface — genuine ViennaRNA folding, genuine codon optimization, genuine manufacturability scoring. No mockups.

Watch the demo